Call 408.493.1800 | Fax 408.493.1801 | Toll Free 800.891.9699 (US Only) | Email: [email protected]

pGB Hsp90 siRNA Vector Mix

pGB expression vector to supress Hsp90 activity in transfected cells
Catalog #: 9518
SKU-Size Size Price Qty
9518-20 20 μg
$495.00
9518-60 60 μg
$895.00
More Sizes Get Quote

Product Details

Highlights • GeneBlocker™ Hsp90 alpha siRNA Vector Mix
• Application- The pGB siRNA vector Mix (1 µg/µl) can be transfected into mammalian cells using Lipofectamine (Invitrogen). For transient transfection, cells can be analyzed in 24-96 hours following transfections, by Western blot analysis or other detection means. For stable transfections, cells can be selected in G418 selection medium to obtain stable cell lines with the specific gene blocked.
• Features and Positions:
Human U6 Promoter: 1-256
Multiple cloning Site: 259-285
3’ Primer: 398-426 (GAAGCATTTATCAGGGTTATTGTCTCATG)
SV40 Promoter: 470-808
Neomycin/Kanamycin Resistance ORF: 843-1634
5’ Primer: 2789-2813 (CGTCGATTTTTGTGATGCTCGTCAG)
pUC Origin of Replication: 2222-3003
Storage Conditions -20°C
Shipping Conditions Gel Pack
USAGE For Research Use Only! Not For Use in Humans.

Details

pGB expression vectors contain the human U6 RNA polymerase III promoter, which directs constitutive, high-level expression of short RNA transcripts in many cells. Each vector also contains the neomycin/kanamycin-resistance gene to provide kanamycin resistance in bacteria and the G418 resistance in mammalian cells. In addition, pGB Cloning vector which is used to clone your own insert and pGB Negative Control vector which contains an insert that does not have significant homology to mammalian genes expressed in human, mouse, and rat, and therefore can be used as a negative control for pGB-expression vectors. The pGB siRNA vectors are designed to suppress the expression of some of the most important apoptosis genes, individually. The mix of four siRNA vectors for each gene has been proven more efficient for gene suppression.


Why buy BioVision Products?
Innovation
Affordability
Global Presence
Technical Support
BioVision aims to provide our customers innovative tools for accelerating drug discovery and biological research. BioVision offers >8,000 products including the most comprehensive array of assay kits for key targets in Metabolic pathways.
BioVision is committed to providing the highest quality products at a competitive price.
We have a broad network of global distributors who are ready to address your research needs and ensure fast delivery.
Our highly trained Technical Support team provides comprehensive product support and is dedicated to resolving your issues quickly and efficiently.