Product Details
Highlights | • (GeneBlocker™ Caspase-8 siRNA Vector, pGB-Casp-8) • Application- The pGB siRNA vectors can be transfected into mammalian cells using Lipofectamine (Invitrogen). For transient transfection, cells can be analyzed in 24-96 hours following transfections, by Western blot analysis or other detection means. For stable transfections, cells can be selected in G418 selection medium to obtain stable cell lines with the specific gene blocked.The pGB cloning vector is designed for cloning your own siRNA insert. • Features and Positions: Human U6 Promoter: 1-256 Multiple cloning Site: 259-285 3’ Primer: 398-426 (GAAGCATTTATCAGGGTTATTGTCTCATG) SV40 Promoter: 470-808 Neomycin/Kanamycin Resistance ORF: 843-1634 5’ Primer: 2789-2813 (CGTCGATTTTTGTGATGCTCGTCAG) pUC Origin of Replication: 2222-3003 |
---|---|
Storage Conditions | -20°C |
Shipping Conditions | Gel Pack |
USAGE | For Research Use Only! Not For Use in Humans. |
Details
![]() |
![]() |
![]() |
![]() |
Innovation |
Affordability |
Global Presence |
Technical Support |
BioVision aims to provide our customers innovative tools for accelerating drug discovery and biological research. BioVision offers >8,000 products including the most comprehensive array of assay kits for key targets in Metabolic pathways. |
BioVision is committed to providing the highest quality products at a competitive price. |
We have a broad network of global distributors who are ready to address your research needs and ensure fast delivery. |
Our highly trained Technical Support team provides comprehensive product support and is dedicated to resolving your issues quickly and efficiently. |