pGB Caspase-1 siRNA Vector

pGB expression vector to supress Caspase 1 activity in transfected cells
Catalog #: 9501 | abID:

Product Details

Highlights • (GeneBlocker™ Caspase-1 siRNA Vector, pGB-Casp-1)
• Application- The pGB siRNA vectors can be transfected into mammalian cells using Lipofectamine (Invitrogen). For transient transfection, cells can be analyzed in 24-96 hours following transfections, by Western blot analysis or other detection means. For stable transfections, cells can be selected in G418 selection medium to obtain stable cell lines with the specific gene blocked.The pGB cloning vector is designed for cloning your own siRNA insert.
• Features and Positions:
Human U6 Promoter: 1-256
Multiple cloning Site: 259-285
3’ Primer: 398-426 (GAAGCATTTATCAGGGTTATTGTCTCATG)
SV40 Promoter: 470-808
Neomycin/Kanamycin Resistance ORF: 843-1634
5’ Primer: 2789-2813 (CGTCGATTTTTGTGATGCTCGTCAG)
pUC Origin of Replication: 2222-3003
Storage Conditions -20°C
Shipping Conditions Gel Pack
USAGE For Research Use Only! Not For Use in Humans.

Details

pGB expression vectors contain the human U6 RNA polymerase III promoter, which directs constitutive, high-level expression of short RNA transcripts in many cells. Each vector also contains the neomycin/kanamycin-resistance gene to provide kanamycin resistance in bacteria and the G418 resistance in mammalian cells. The pGB vector is used to clone your own insert. The vector contains two unique restriction sites, BamH I and Xba I for directional cloning. The pGB Negative Control vector contains a insert that does not have significant homology to mammalian genes expressed in human, mouse, and rat, and it can be used as a negative control for pGB-Caspase siRNA vectors. The pGB Caspase siRNA vectors contain the siRNA inserts designed to suppress the expression of each caspase individually


Why buy BioVision Products?
Innovation
Affordability
Global Presence
Technical Support
BioVision aims to provide our customers innovative tools for accelerating drug discovery and biological research. BioVision offers >8,000 products including the most comprehensive array of assay kits for key targets in Metabolic pathways.
BioVision is committed to providing the highest quality products at a competitive price.
We have a broad network of global distributors who are ready to address your research needs and ensure fast delivery.
Our highly trained Technical Support team provides comprehensive product support and is dedicated to resolving your issues quickly and efficiently.